SubtiBank SubtiBank
yocH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yocH

peptidoglycan hydrolase (amidase)
locus
BSU_19210
pI
8.37
mw
30.03 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
cell wall turnover
product
peptidoglycan hydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,092,899 → 2,093,762

    The protein

    [SW|Domains]

  • contains two N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
  • 2 [SW|LysM domain]s (aa 26-69, aa 78-121) (according to UniProt)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]
    description
    [Pubmed|12950927]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12950927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|12950927], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    genes
    [gene|E85341621B3835F63F07C506E08B73A92E588B1F|bsrA]-[gene|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|recQ]-[gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A321 (yocH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/321 NBRP B. subtilis, Japan]
  • AH023 knock-out mutant (kan), available in [SW|Kevin Devine]'s and [SW|Jörg Stülke]'s labs [Pubmed|17581128]
  • BKE19210 (''[gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE19210 (Δ[gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTAAATCCTCCCTTG, downstream forward: _UP4_TAATAATATAGATTGTGATA
  • BKK19210 (Δ[gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTAAATCCTCCCTTG, downstream forward: _UP4_TAATAATATAGATTGTGATA
  • Expression vectors

  • pGP1691, expression of ''yocH''-Strep in ''B. subtilis'', in [SW|pGP382], available in [SW|Jörg Stülke]'s lab
  • pGP1693, expression of ''yocH''-Strep in ''E. coli'', in [SW|pGP574], available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Kevin Devine]
  • References

    Reviews

  • 18430080
  • Original publications

  • 14651647,15101989,18957862,12950927,20059685,20070526,23199363,17581128