SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


peptidoglycan hydrolase (amidase)
30.03 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
cell wall turnover
peptidoglycan hydrolase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,092,899 → 2,093,762

    The protein


  • contains two N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
  • 2 [SW|LysM domain]s (aa 26-69, aa 78-121) (according to UniProt)
  • Structure

  • [PDB|4WLK] ([protein|3DAE76660E0CB213155265A3E8DF78A992883F87|YuiC], corresponds to aa 155 ... 286 of [protein|BEBA71A2EF56DAEAF80924856DA68124805BB158|YocH], 34% identity) [pubmed|26163297]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12950927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|12950927], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • expression is modulated in response to D,L-endopeptidase activity (increased upon reduced activity in the absence of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] or [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX], decreased upon overexpression of [protein|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|LytE]) ([protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]) [pubmed|31808740]
  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-A321 (yocH::erm), available at the [ NBRP B. subtilis, Japan]
  • AH023 knock-out mutant (kan), available in [SW|Kevin Devine]'s and [SW|Jörg Stülke]'s labs [Pubmed|17581128]
  • BKE19210 (''[gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE19210 (Δ[gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTAAATCCTCCCTTG, downstream forward: _UP4_TAATAATATAGATTGTGATA
  • BKK19210 (Δ[gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTAAATCCTCCCTTG, downstream forward: _UP4_TAATAATATAGATTGTGATA
  • Expression vectors

  • pGP1691, expression of ''yocH''-Strep in ''B. subtilis'', in [SW|pGP382], available in [SW|Jörg Stülke]'s lab
  • pGP1693, expression of ''yocH''-Strep in ''E. coli'', in [SW|pGP574], available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Kevin Devine]
  • References


  • 18430080
  • Original publications

  • 14651647,15101989,18957862,12950927,20059685,20070526,23199363,17581128,31808740,26163297