SubtiBank SubtiBank
yomR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yomR

similar to phage-related protein
locus
BSU_21250
pI
6.42
mw
44.66 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,242,414 → 2,243,631

    Biological materials

    Mutant

  • BKE21250 (Δ[gene|BEB95A1F843F4D3B51B6E151137453F797342FE2|yomR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCGACGTATTTACTGCTGC, downstream forward: _UP4_GTTCCGTTGAATTAGGAGGT
  • BKK21250 (Δ[gene|BEB95A1F843F4D3B51B6E151137453F797342FE2|yomR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCGACGTATTTACTGCTGC, downstream forward: _UP4_GTTCCGTTGAATTAGGAGGT