You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
cheD [2019-04-16 12:07:17]
chemoreceptor deaminase, required for methylation of methyl-accepting chemotaxis proteins by
CheR, enhances phosphatase activity of
CheC, required for full
McpC activity
Molecular weight
17.86 kDa
Product
protein deaminase,
CheC activity modulator
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,715,970 → 1,716,470
Phenotypes of a mutant
not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed The protein
Catalyzed reaction/ biological activity
binds chemoreceptors and increases their ability to activate the kinase activity of CheA PubMedProtein L-glutamine + H2O = protein L-glutamate + NH3 (according to Swiss-Prot)deaminates Gln-586, Gln-593, and Gln594 in McpA PubMeddeaminates Gln-609 in McpC PubMed Protein family
cheD family (according to Swiss-Prot)Structure
2F9Z (from Thermotoga maritima, 41% identity) PubMed Expression and Regulation
Biological materials
Mutant
1A861 ( cheD::cat), PubMed, available at BGSC1A863 ( cheD::cat), PubMed, available at BGSCDS6868 (marker-less in NCIB3610) PubMedBKE16460 (ΔcheD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATAACAACAGCCTCAGTTG, downstream forward: _UP4_TAATTAAGGTATTAGGGGGABKK16460 (ΔcheD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATAACAACAGCCTCAGTTG, downstream forward: _UP4_TAATTAAGGTATTAGGGGGA References
Reviews
Loading
Original publications
Loading