SubtiBank SubtiBank
cheD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cheD

chemoreceptor deaminase, required for methylation of methyl-accepting chemotaxis proteins by [protein|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|CheR], enhances phosphatase activity of [protein|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|CheC], required for full [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC] activity
locus
BSU_16460
pI
9.35
mw
17.86 kDa
protein length
166 aa Sequence Blast
gene length
501 bp Sequence Blast
function
[SW|motility and chemotaxis]
product
protein deaminase, [protein|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|CheC] activity modulator
essential
no
ec
3.5.1.44
synonyms
ylxK

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.7|Protein deaminase]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.1|Soluble signalling proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.6|Other proteins required for efficient pellicle biofilm formation]
  • Gene

    Coordinates
    1,715,970 → 1,716,470

    Phenotypes of a mutant

  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • The protein

    Catalyzed reaction/ biological activity

  • binds chemoreceptors and increases their ability to activate the kinase activity of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] [Pubmed|23226535]
  • H2O + L-glutaminyl-[protein] --> L-glutamyl-[protein] + NH4+ (according to UniProt)
  • deaminates Gln-586, Gln-593, and Gln594 in [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|McpA] [Pubmed|22931217]
  • deaminates Gln-609 in [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC] [Pubmed|22931217]
  • Protein family

  • CheD family (single member, according to UniProt)
  • Structure

  • [PDB|2F9Z] (from Thermotoga maritima, 41% identity) [pubmed|16469702]
  • Expression and Regulation

    Operons

    genes
    [gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
    description
    [Pubmed|20233303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab

    genes
    [gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
    description
    [Pubmed|9657996,8157612,15175317]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • 1A861 ( ''cheD''::''cat''), [Pubmed|7893679], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A861&Search=1A861 BGSC]
  • 1A863 ( ''cheD''::''cat''), [Pubmed|7893679], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A863&Search=1A863 BGSC]
  • DS6868 (marker-less in NCIB3610) [Pubmed|25313396]
  • BKE16460 (Δ[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATAACAACAGCCTCAGTTG, downstream forward: _UP4_TAATTAAGGTATTAGGGGGA
  • BKK16460 (Δ[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATAACAACAGCCTCAGTTG, downstream forward: _UP4_TAATTAAGGTATTAGGGGGA
  • References

    Reviews

  • 18774298,18990184
  • Original publications

  • 25313396,26122431,17850253,21515776,22931217,23226535,7893679,15317802,17908686,12011078,8866475,11722727,9194713,14651647,9657996,8157612,15175317,16469702,24386445,25039821,16469702