SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


UV-damage repair protein
46.57 kDa
protein length
416 aa Sequence Blast
gene length
1251 bp Sequence Blast
DNA repair after UV damage
UV-damage repair protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,270,407 → 2,271,657

    The protein

    Protein family

  • [SW|DNA polymerase type-Y family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C87D33852F263A553CA747608E6200E4AD8344B5|PolY1], [protein|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|PolY2]
  • [SW|Domains]

  • [SW|UmuC domain] (aa 12-196) (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials


  • BKE21500 (Δ[gene|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|uvrX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCAATCATTGTATGTAAC, downstream forward: _UP4_TAAGATAAATTTAAACTTAT
  • BKK21500 (Δ[gene|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|uvrX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCAATCATTGTATGTAAC, downstream forward: _UP4_TAAGATAAATTTAAACTTAT
  • References

  • 16267290,30916324