SubtiBank SubtiBank
yfhO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfhO

required for lipoteichoic acid glycosylation
locus
BSU08610
pI
9.63
mw
93.56 kDa
protein length
861 aa Sequence Blast
gene length
2586 bp Sequence Blast
function
lipoteichoic acid glycosylation
product
glycosyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    931,879 → 934,464

    Phenotypes of a mutant

  • expression of [protein|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|CsbB] in the absence of [protein|BDFB6CCB5AAD9747971DE6B78E07558706E04617|YfhO] causes constitutive activation of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] [Pubmed|23632331]
  • The protein

    Catalyzed reaction/ biological activity

  • moves GlcNAc sugar moieties from a C55-P intermediate onto the lipoteichoic acid backbone on the outside of the cell [pubmed|29343515]
  • [SW|Domains]

  • 13 predicted transmembrane helices and a large extracellular loop of 389 amino acids connecting the last two transmembrane helices [pubmed|29343515]
  • [SW|Localization]

  • cell membrane, with large extracellular loop [pubmed|29343515]
  • Expression and Regulation

    Operons

    genes
    [gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]-[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]
    description
    [Pubmed|22383849,8921856]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8921856,9636707], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|8921856,15805528,9636707]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C320 (yfhO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2318 NBRP B. subtilis, Japan]
  • BKE08610 (Δ[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATTCTCCAGTCTT, downstream forward: _UP4_CTCGTCAGTCTGCTGCTTGC
  • BKK08610 (Δ[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATTCTCCAGTCTT, downstream forward: _UP4_CTCGTCAGTCTGCTGCTTGC
  • References

  • 23632331,29343515