SubtiBank SubtiBank
yfhO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfhO

required for lipoteichoic acid glycosylation
locus
BSU_08610
pI
9.63
mw
93.56 kDa
protein length
861 aa Sequence Blast
gene length
2586 bp Sequence Blast
function
lipoteichoic acid glycosylation
product
glycosyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    931,879 → 934,464

    Phenotypes of a mutant

  • expression of [protein|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|CsbB] in the absence of [protein|BDFB6CCB5AAD9747971DE6B78E07558706E04617|YfhO] causes constitutive activation of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] [Pubmed|23632331]
  • The protein

    Catalyzed reaction/ biological activity

  • moves GlcNAc sugar moieties from a C55-P intermediate onto the lipoteichoic acid backbone on the outside of the cell [pubmed|29343515]
  • [SW|Domains]

  • 13 predicted transmembrane helices and a large extracellular loop of 389 amino acids connecting the last two transmembrane helices [pubmed|29343515]
  • [SW|Localization]

  • cell membrane, with large extracellular loop [pubmed|29343515]
  • Expression and Regulation

    Operons

    genes
    [gene|824E6AE2FFA3CBC9F90648F15178A00A6CC49E4C|csbB]-[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]
    description
    [Pubmed|22383849,8921856]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8921856,9636707], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|8921856,15805528,9636707]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C320 (yfhO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2318 NBRP B. subtilis, Japan]
  • BKE08610 (Δ[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATTCTCCAGTCTT, downstream forward: _UP4_CTCGTCAGTCTGCTGCTTGC
  • BKK08610 (Δ[gene|BDFB6CCB5AAD9747971DE6B78E07558706E04617|yfhO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATTCTCCAGTCTT, downstream forward: _UP4_CTCGTCAGTCTGCTGCTTGC
  • References

  • 23632331,29343515