SubtiBank SubtiBank
ydhU/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydhU/2

similar to Mn catalase, inactive pseudogene in strain 168
locus
BSU_05899
pI
0.00
mw
0.00 kDa
protein length
gene length
126 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    634,651 → 634,776

    Expression and Regulation

    Operons

    genes
    [gene|BDDD52CE09533CFD6557B933F2AE1C9B94F9708B|ydhU/2]-[gene|F7C5C38298E1F1EF13A11332C92EA624D9381A3E|ydhU/1]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    genes
    [gene|BDDD52CE09533CFD6557B933F2AE1C9B94F9708B|ydhU/2]
    description
    [Pubmed|12354229]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE05899 (Δ[gene|BDDD52CE09533CFD6557B933F2AE1C9B94F9708B|ydhU/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05899 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACACGCCTCATTTCTT, downstream forward: _UP4_GAAATGCGTACAATGATGCA
  • BKK05899 (Δ[gene|BDDD52CE09533CFD6557B933F2AE1C9B94F9708B|ydhU/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05899 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACACGCCTCATTTCTT, downstream forward: _UP4_GAAATGCGTACAATGATGCA