SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to Mn catalase, inactive pseudogene in strain 168
0.00 kDa
protein length
gene length
126 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    634,651 → 634,776

    Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab


    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials


  • BKE05899 (Δ[gene|BDDD52CE09533CFD6557B933F2AE1C9B94F9708B|ydhU/2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACACGCCTCATTTCTT, downstream forward: _UP4_GAAATGCGTACAATGATGCA
  • BKK05899 (Δ[gene|BDDD52CE09533CFD6557B933F2AE1C9B94F9708B|ydhU/2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACACGCCTCATTTCTT, downstream forward: _UP4_GAAATGCGTACAATGATGCA