SubtiBank SubtiBank
yhzB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhzB

unknown
locus
BSU_08900
pI
4.87
mw
23.31 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    967,229 → 967,852

    Expression and Regulation

    Operons

    genes
    [gene|BDBBAE4995E77FD0978412985E4D49A3A39BC5F7|yhzB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B468 (yhzB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1467 NBRP B. subtilis, Japan]
  • BKE08900 (Δ[gene|BDBBAE4995E77FD0978412985E4D49A3A39BC5F7|yhzB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGCATTCACTCCAGTT, downstream forward: _UP4_TAAAAGAACACGAATACCGT
  • BKK08900 (Δ[gene|BDBBAE4995E77FD0978412985E4D49A3A39BC5F7|yhzB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGCATTCACTCCAGTT, downstream forward: _UP4_TAAAAGAACACGAATACCGT