SubtiBank SubtiBank
fecD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fecD

iron/citrate [SW|ABC transporter] (permease)
locus
BSU07510
pI
9.70
mw
34.94 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast
function
[SW|acquisition of iron]
product
iron/citrate [SW|ABC transporter] (permease)
essential
no
synonyms
yfmD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    824,714 → 825,715

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3E1C925C31C00803982C8EB1C6B025C22DB4A828|FhuB], [protein|81494D4E7E52531802C3C0D0073739DA9375F5DF|YfiZ], [protein|57402D137E3D3791CAF0696421224F4E1DC1BA48|FeuB], [protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|FecE]
  • Structure

  • [PDB|4G1U] (from ''Yersinia pestis'', the [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|FecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|FecE]-[protein|E76640F895261DA34AD2342B54B43D11857AEA9A|FecF] complex, 34% identity) [Pubmed|23142986]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]-[gene|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[gene|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]-[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]
    description
    [Pubmed|16672620]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620,12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,16672620,12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C330 (yfmD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2328 NBRP B. subtilis, Japan]
  • BKE07510 (Δ[gene|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAGTCTCACTTCCTTAC, downstream forward: _UP4_GCAAGGAAAGGGCGAAACCT
  • BKK07510 (Δ[gene|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAGTCTCACTTCCTTAC, downstream forward: _UP4_GCAAGGAAAGGGCGAAACCT
  • References

  • 10092453,16672620,12354229,23142986,29133393