SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative C-N hydrolase
60.02 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    998,402 → 999,943

    The protein

    Protein family

  • carbon-nitrogen hydrolase superfamily (with [protein|CB12BCCF6CEADC0C64DD918E0BAE4748E358A67B|MtnU], according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 14-212) (according to UniProt)
  • CN hydrolase (aa 229-484) (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A672 (yhcX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09250 (Δ[gene|BDAA216E832B8EB267CED6456A0045254DD0E97D|yhcX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCAGACAACCTACTCGCTC, downstream forward: _UP4_TAATTCCCAAAAAACCCGCC
  • BKK09250 (Δ[gene|BDAA216E832B8EB267CED6456A0045254DD0E97D|yhcX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCAGACAACCTACTCGCTC, downstream forward: _UP4_TAATTCCCAAAAAACCCGCC
  • References

  • 22383849