SubtiBank SubtiBank
yisL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yisL

unknown
locus
BSU_10760
pI
10.28
mw
13.08 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,153,265 → 1,153,621

    The protein

    Protein family

  • UPF0344 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|07E876715DCF551B8BDB6AA5D33C700696B4E730|yisK]-[gene|BDA8B49AC4AE81383D84337C7FEE9D88EA92AED3|yisL]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|27215790], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|27215790], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B215 (yisL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1214 NBRP B. subtilis, Japan]
  • BKE10760 (Δ[gene|BDA8B49AC4AE81383D84337C7FEE9D88EA92AED3|yisL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATGTTCCCCCTATCA, downstream forward: _UP4_TAATAGAAAAACCTATGAAC
  • BKK10760 (Δ[gene|BDA8B49AC4AE81383D84337C7FEE9D88EA92AED3|yisL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATGTTCCCCCTATCA, downstream forward: _UP4_TAATAGAAAAACCTATGAAC