SubtiBank SubtiBank
epsH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

epsH

undecaprenyl (UnDP) priming UDP-N-acetyl-glucosamine transferase, synthesis of extracellular poly-N-acetylglucosamine
locus
BSU_34300
pI
5.79
mw
39.65 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
function
synthesis of extracellular poly-N-acetylglucosamine
product
undecaprenyl (UnDP) priming UDP-N-acetyl-glucosamine transferase
essential
no
synonyms
yveR

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.1|Matrix polysaccharide synthesis]
  • Gene

    Coordinates
    3,521,111 → 3,522,145

    Phenotypes of a mutant

  • altered cell death pattern in colonies [Pubmed|23012477]
  • The protein

    Catalyzed reaction/ biological activity

  • production of UnDP-3-O-acyl N- acetylglucosamine [Pubmed|26078454]
  • Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5272E807B6B98541EA155AA9748320E25767F096|EpsJ]
  • Expression and Regulation

    Operons

    genes
    [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
    description
    [Pubmed|15661000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541]
  • expression is increased in [gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX] mutants [pubmed|32483306]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A067 (yveR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/67 NBRP B. subtilis, Japan]
  • BKE34300 (Δ[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGACCGGCTCCTCGT, downstream forward: _UP4_AAAATGAGAAACAGAGGGTG
  • BKK34300 (Δ[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGACCGGCTCCTCGT, downstream forward: _UP4_AAAATGAGAAACAGAGGGTG
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

    Reviews

  • 20735481
  • The EAR [SW|RNA switch]

  • 20374491,20230605