SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to macrolide glycosyltransferase
42.87 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    618,095 → 619,282

    The protein

    Protein family

  • UDP-glycosyltransferase family (with [protein|02927D2CC9F44B99DB307DDFED2DD52DE2196120|YjiC] and [protein|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|YojK], according to UniProt)
  • Structure

  • [PDB|2IYA] (from Streptomyces antibioticus, 28% identity) [pubmed|17376874]
  • Expression and Regulation



    regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, weak, in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • view in new tab

    Biological materials


  • MGNA-C180 (ydhE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05720 (Δ[gene|BD82663B1BF2763D2D2DE710C2896E4155419324|ydhE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAGACAACTCCCTCTC, downstream forward: _UP4_TAAGAAAAAGAACTCCCGTA
  • BKK05720 (Δ[gene|BD82663B1BF2763D2D2DE710C2896E4155419324|ydhE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAGACAACTCCCTCTC, downstream forward: _UP4_TAAGAAAAAGAACTCCCGTA
  • References

  • 20639339,27130432,17376874,31786106