SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


28.92 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,611,654 → 1,612,427

    The protein

    Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to Interpro)
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 181-251) (according to UniProt)
  • Structure

  • [PDB|2FPH] (from Streptococcus pneumoniae, N-terminal domain, corresponds to aa 4 ... 158, 32% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • MGNA-B364 (ylmH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15410 (Δ[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCTTTCCCTTCTATG, downstream forward: _UP4_TAGTCGGTTTTTCAGTTTTT
  • BKK15410 (Δ[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCTTTCCCTTCTATG, downstream forward: _UP4_TAGTCGGTTTTTCAGTTTTT
  • References

  • 14651647,16420366