SubtiBank SubtiBank
ywgA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywgA

unknown
locus
BSU_37590
pI
5.19
mw
19.59 kDa
protein length
166 aa Sequence Blast
gene length
501 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,858,999 → 3,859,499

    Expression and Regulation

    Operons

    genes
    [gene|1EC8C3FC0B3BAC12CB7C5C0E1F4886E198AA1D53|ywzC]-[gene|268A50A41FB6CAB0D768201996C5DF5DADCCA0B7|ywfO]-[gene|BD23EC2EAC16D3A4BCAE19222E29C2F8AEB30AA6|ywgA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A586 (ywgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/586 NBRP B. subtilis, Japan]
  • BKE37590 (Δ[gene|BD23EC2EAC16D3A4BCAE19222E29C2F8AEB30AA6|ywgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTCCCGACATCTCCTT, downstream forward: _UP4_TAACCATACCAAGCAAAAGA
  • BKK37590 (Δ[gene|BD23EC2EAC16D3A4BCAE19222E29C2F8AEB30AA6|ywgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTCCCGACATCTCCTT, downstream forward: _UP4_TAACCATACCAAGCAAAAGA
  • References

  • 9353933