SubtiBank SubtiBank
yhdV
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhdV

flouride exporter (together with [protein|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|FluC])
locus
BSU_09610
pI
10.36
mw
13.77 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
export of flouride
product
flouride channel
essential
no
synonyms
crcBB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,037,306 → 1,037,701

    Phenotypes of a mutant

  • very sensitive to flouride [pubmed|30430725]
  • The protein

    Protein family

  • CrcB (TC 9.B.71) family, (together with [protein|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|FluC], according to UniProt)
  • Paralogous protein(s)

  • [protein|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|FluC]
  • Structure

  • [PDB|6B2A] (from E. coli, 35% identity, aa 6 ... 115) [pubmed|28952925]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|04CACAF4F786090AB67D7C606C944F07B7A7FE55|yhdW]-[gene|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|yhdV]-[gene|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|fluC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A699 (yhdV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/699 NBRP B. subtilis, Japan]
  • BKE09610 (Δ[gene|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|yhdV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCGCGCCTCCGATAAAAA, downstream forward: _UP4_CAAAGAAAGGGGCTGCAGGA
  • BKK09610 (Δ[gene|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|yhdV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCGCGCCTCCGATAAAAA, downstream forward: _UP4_CAAAGAAAGGGGCTGCAGGA
  • References

    Reviews

  • 28514705
  • Research papers

  • 28952925,23991286,30430725