SubtiBank SubtiBank
steT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

steT

serine/ threonine exchanger transporter
locus
BSU12860
pI
9.18
mw
46.99 kDa
protein length
438 aa Sequence Blast
gene length
1317 bp Sequence Blast
function
exchange of serine and threonine
product
serine/ threonine exchanger transporter
essential
no
synonyms
ykbA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,351,375 → 1,352,691

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Structure

  • [PDB|6F34] (from Geobacillus kaustophilus, 25% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]
    description
    [Pubmed|22383849]

    regulation

  • expression activated by glucose (4.2 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • GP2378 ∆''[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]'' ::''cat'', available in [SW|Jörg Stülke]'s lab
  • GP2945 ∆''[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]'' ::''kan'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A736 (ykbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/736 NBRP B. subtilis, Japan]
  • BKE12860 (Δ[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTTAACCTCCTATG, downstream forward: _UP4_TGATAAAACGGTTCCCTTGT
  • BKK12860 (Δ[gene|BCED6015E8CD17F94E9D0BC6CFEB15BF42F890A5|steT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTTAACCTCCTATG, downstream forward: _UP4_TGATAAAACGGTTCCCTTGT
  • Expression vector

  • pGP2281: expression of ''steT'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2275 (in [SW|pAC5]) (GP2962), available in [SW|Jörg Stülke]'s lab
  • References

  • 17344220,12850135,19419962,20610400,26976827,29416041