SubtiBank SubtiBank
yvmC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvmC

cyclodipeptide synthase
locus
BSU_35070
pI
6.61
mw
28.36 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
biosynthesis of the extracellular iron chelator pulcherrimin
product
cyclodipeptide synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • Gene

    Coordinates
    3,603,821 → 3,604,567

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of the cyclic dipeptide cyclo-L-leucyl-L-leucyl with the corresponding charged tRNAs as substrates in an ATP-dependent manner [Pubmed|19430487]
  • 2 L-leucyl-tRNALeu --> cyclo(L-leucyl-L-leucyl) + 2 H+ + 2 tRNALeu (according to UniProt)
  • Protein family

  • CDPS family (single member, according to UniProt)
  • Structure

  • [PDB|3S7T] (from ''B. licheniformis'', 70% identity, 86% similarity) [Pubmed|21325056]
  • Expression and Regulation

    Operons

    genes
    [gene|BCE1D8CDDF07396583FF50C4C192785545244BE2|yvmC]-[gene|D63EDBB6AA33708E8352F6208A9BA18CAEE0DC53|cypX]
    description
    [http://www.liebertonline.com/doi/pdf/10.1089/ind.2006.2.66 Reference]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]: repression, in [regulon|0D555F2AB7DC863E6FF388888308E980514DB719|PchR regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • BKE35070 (Δ[gene|BCE1D8CDDF07396583FF50C4C192785545244BE2|yvmC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATTCACCCCTAAAA, downstream forward: _UP4_TGATAGGGGGAGTAAAACAT
  • BKK35070 (Δ[gene|BCE1D8CDDF07396583FF50C4C192785545244BE2|yvmC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATTCACCCCTAAAA, downstream forward: _UP4_TGATAGGGGGAGTAAAACAT
  • References

  • 19430487,220817675,21325056,27542896,31113899,4204912