SubtiBank SubtiBank
hutP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hutP

transcriptional antiterminator of the [gene|search|hut ]operon
locus
BSU39340
pI
6.06
mw
16.43 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
regulation of histidine utilization
product
transcriptional antiterminator
essential
no
synonyms
hutP1

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.5|Utilization of histidine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • Gene

    Coordinates
    4,041,483 → 4,041,938

    The protein

    Protein family

  • hutP family (according to Swiss-Prot)
  • [SW|Cofactors]

  • Mg2+ [pubmed|29035529]
  • Effectors of protein activity

  • HutP binds its RNA target to cause antitermination in the presence of histidine [Pubmed|23748184]
  • Structure

  • [PDB|3BOY] (complex bound to the [gene|search|hut ]mRNA), [PDB|1WPT]
  • Expression and Regulation

    Operons

    genes
    [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]-[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]-[gene|ED6002BB56B96F9A2B4F80CA050518B266000E55|hutU]-[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]-[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]-[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8071225], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8071225], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8682780], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|HutP]: antitermination, at a protein-dependent [SW|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|HutP regulon]
  • regulation

  • induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
  • view in new tab

    Biological materials

    Mutant

  • BKE39340 (Δ[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCACTCAATTCC, downstream forward: _UP4_TGAAACAGCCCATAGATCTT
  • BKK39340 (Δ[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCACTCAATTCC, downstream forward: _UP4_TGAAACAGCCCATAGATCTT
  • References

    Reviews

  • 17395359,16427271,22933560,31100987
  • Research papers

  • 28510182,23748184,10712704,18445631,15758992,15242603,14763987,15273277,18445631,8071225,16192572,29035529