SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


purine nucleoside phosphorylase
28.98 kDa
protein length
271 aa Sequence Blast
gene length
816 bp Sequence Blast
purine salvage and interconversion
purine nucleoside phosphorylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Purine salvage and interconversion]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,446,418 → 2,447,233

    The protein

    Catalyzed reaction/ biological activity

  • Purine nucleoside + phosphate = purine + alpha-D-ribose 1-phosphate (according to Swiss-Prot) RNA(n+1) + phosphate = RNA(n) + a nucleoside diphosphate (according to Swiss-Prot)
  • Protein family

  • PNP/MTAP phosphorylase family (according to Swiss-Prot) polyribonucleotide nucleotidyltransferase family (according to Swiss-Prot)
  • Modification

  • phosphorylation on Ser-28 [Pubmed|17218307]
  • Structure

  • [PDB|3LA8] (from Streptococcus mutans, 57% identity)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10537218], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of nucleosides (deoxyribose 5-phosphate and ribose 5-phosphate act as molecular inducers) [Pubmed|10537218]
  • view in new tab

    Biological materials


  • BKE23490 (Δ[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCCTTCAAGAAACAGT, downstream forward: _UP4_TAAATATGAATCAATGCAGG
  • BKK23490 (Δ[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCCTTCAAGAAACAGT, downstream forward: _UP4_TAAATATGAATCAATGCAGG
  • References

  • 10537218,22900538,17218307