SubtiBank SubtiBank
treP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

treP

trehalose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW 1.2.2|PTS]
locus
BSU_07800
pI
8.56
mw
49.84 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
trehalose uptake and phosphorylation
product
trehalose-specific [category|SW 1.2.2|PTS] permease, EIIBC component
essential
no
ec
2.7.1.69
synonyms
treB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.20|Utilization of trehalose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    Coordinates
    850,367 → 851,779

    The protein

    Catalyzed reaction/ biological activity

  • α,α-trehalose + Nπ-phospho-L-histidyl-[protein] --> α,α-trehalose 6-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|531F132F7F6A878F1E1D56977B9898A14272349A|SacX], [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|SacP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|MurP], [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP]
  • [SW|Domains]

  • [SW|PTS EIIB domain] type-1 (aa 1-88) (according to UniProt)
  • [SW|PTS EIIC domain] type-1 (aa 108-470) (according to UniProt)
  • Structure

  • [PDB|2IPJ] (from Clostridium difficile, the [SW|PTS EIIB domain], 41.4% identity) [pubmed|17442338]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]-[gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]-[gene|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR]
    description
    [Pubmed|8755887]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8755887], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR]: repression, [Pubmed|8755887], in [regulon|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18977770], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|21636651], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|21636651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C259 (treP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2257 NBRP B. subtilis, Japan]
  • BKE07800 (Δ[gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAACCCCTCCGTATC, downstream forward: _UP4_TAACAAGTGGGGAGCGGGAC
  • BKK07800 (Δ[gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAACCCCTCCGTATC, downstream forward: _UP4_TAACAAGTGGGGAGCGGGAC
  • References

  • 8755887,9829827,18977770,8917076,21636651,10627040,22900538,11918677,30038046,17442338