SubtiBank SubtiBank
treP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

treP

trehalose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW 1.2.2|PTS]
locus
BSU_07800
pI
8.56
mw
49.84 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
trehalose uptake and phosphorylation
product
trehalose-specific [category|SW 1.2.2|PTS] permease, EIIBC component
essential
no
ec
2.7.1.69
synonyms
treB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.20|Utilization of trehalose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    Coordinates
    850,367 → 851,779

    The protein

    Catalyzed reaction/ biological activity

  • α,α-trehalose + Nπ-phospho-L-histidyl-[protein] --> α,α-trehalose 6-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|531F132F7F6A878F1E1D56977B9898A14272349A|SacX], [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|SacP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|MurP], [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP]
  • [SW|Domains]

  • [SW|PTS EIIB domain] type-1 (aa 1-88) (according to UniProt)
  • [SW|PTS EIIC domain] type-1 (aa 108-470) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]-[gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]-[gene|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR]
    description
    [Pubmed|8755887]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8755887], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR]: repression, [Pubmed|8755887], in [regulon|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18977770], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|21636651], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|21636651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C259 (treP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2257 NBRP B. subtilis, Japan]
  • BKE07800 (Δ[gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAACCCCTCCGTATC, downstream forward: _UP4_TAACAAGTGGGGAGCGGGAC
  • BKK07800 (Δ[gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAACCCCTCCGTATC, downstream forward: _UP4_TAACAAGTGGGGAGCGGGAC
  • References

  • 8755887,9829827,18977770,8917076,21636651,10627040,22900538,11918677,30038046