SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


NADH oxidase
22.19 kDa
protein length
202 aa Sequence Blast
gene length
609 bp Sequence Blast
regeneration of NAD from NADH
NADH oxidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,127,813 → 2,128,421

    The protein

    Catalyzed reaction/ biological activity

  • regeneration of NAD from NADH [Pubmed|26312069]
  • Protein family

  • type A lantibiotic family (according to Swiss-Prot)
  • Structure

  • [PDB|3GE6] (from '' Exiguobacterium sibiricum'', 42% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, [Pubmed|18208493], in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • view in new tab

    Biological materials


  • MGNA-B434 (yodC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG, downstream forward: _UP4_TAAGGATATGAAAAACCTTA
  • BKK19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG, downstream forward: _UP4_TAAGGATATGAAAAACCTTA
  • References

  • 17407181,18208493,26312069