SubtiBank SubtiBank
yodC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yodC

NADH oxidase
locus
BSU_19550
pI
5.27
mw
22.19 kDa
protein length
202 aa Sequence Blast
gene length
609 bp Sequence Blast
function
regeneration of NAD from NADH
product
NADH oxidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,127,813 → 2,128,421

    The protein

    Catalyzed reaction/ biological activity

  • regeneration of NAD from NADH [Pubmed|26312069]
  • Protein family

  • [SW|nitroreductase family] (according to UniProt)
  • Structure

  • [PDB|3GE6] (from '' Exiguobacterium sibiricum'', 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, [Pubmed|18208493], in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B434 (yodC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1433 NBRP B. subtilis, Japan]
  • BKE19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG, downstream forward: _UP4_TAAGGATATGAAAAACCTTA
  • BKK19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|yodC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG, downstream forward: _UP4_TAAGGATATGAAAAACCTTA
  • References

  • 17407181,18208493,26312069