SubtiBank SubtiBank
rapJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rapJ

response regulator aspartate phosphatase, dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P
locus
BSU_02820
pI
4.90
mw
44.25 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
function
control of the [SW|phosphorelay]
product
response regulator aspartate phosphatase
essential
no
synonyms
ycdE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • Gene

    Coordinates
    304,430 → 305,551

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P [Pubmed|21346797]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • RapJ is made up of the C-terminal tetratricopeptide repeat (TPR) domain (five [SW|TPR repeat|tetratrichopeptide repeats]) that is connected by a flexible helix containing linker to the N-terminal 3-helix bundle. Upon binding of the regulating peptide [protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|PhrC], the 3-helix bundle and the linker helix undergo a conformational change to form a TPR-like fold that merges with the existing C-terminal TPR domain. [Pubmed|23526881]
  • Effectors of protein activity

  • the interaction with [protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|PhrC] inactivates [protein|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|RapJ] [Pubmed|23526881]
  • Structure

  • [PDB|4GYO] (complex [protein|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|RapJ]-[protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|PhrC]) [Pubmed|23526881]
  • Expression and Regulation

    Operons

    genes
    [gene|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE02820 (Δ[gene|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCTGCCTCCTTCCT, downstream forward: _UP4_TAGGAAATGGCAGAGAACTA
  • BKK02820 (Δ[gene|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCTGCCTCCTTCCT, downstream forward: _UP4_TAGGAAATGGCAGAGAACTA
  • References

  • 21346797,23526881