SubtiBank SubtiBank
sdaAB [2019-02-24 17:45:41]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sdaAB [2019-02-24 17:45:41]

L-serine deaminase
locus
BSU15850
pI
5.10
mw
23.67 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
function
serine utilization
product
L-serine deaminase (beta chain)
essential
no
ec
4.3.1.17
synonyms
yloW,sdaA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.7|Utilization of alanine/ serine]
  • Gene

    Coordinates
    1,658,242 → 1,658,904

    The protein

    Catalyzed reaction/ biological activity

  • L-serine = pyruvate + NH3 (according to Swiss-Prot)
  • Protein family

  • ACT domain (according to Swiss-Prot)
  • [SW|Domains]

  • [SW|ACT domain] (aa 148 ... 220) (according to the Interpro database)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Expression and Regulation

    Operons

    genes
    [gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]-[gene|8361D87307D2E8350945F592ABD24E2109E2E81A|sdaAA]-[gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE15850 (Δ[gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATTCCTCCTTATGA, downstream forward: _UP4_TAGCGAAAAGGGTCAGGAGG
  • BKK15850 (Δ[gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATTCCTCCTTATGA, downstream forward: _UP4_TAGCGAAAAGGGTCAGGAGG
  • lacZ fusion

  • pGP2275 (in [protein|search|pAC5]) (GP2967), available in [SW|Jörg Stülke]'s lab
  • References

  • 22383849,22686449,24161940