SubtiBank SubtiBank
sdaAB [2018-01-03 11:56:27]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sdaAB [2018-01-03 11:56:27]

L-serine deaminase
23.67 kDa
protein length
220 aa Sequence Blast
gene length
660 bp Sequence Blast
serine utilization
L-serine deaminase (beta chain)
yloW, sdaA

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of alanine/ serine]
  • Gene

    1,658,242 → 1,658,904

    The protein

    Catalyzed reaction/ biological activity

  • L-serine = pyruvate + NH3 (according to Swiss-Prot)
  • Protein family

  • ACT domain (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE15850 (Δ[gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATTCCTCCTTATGA, downstream forward: _UP4_TAGCGAAAAGGGTCAGGAGG
  • BKK15850 (Δ[gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATTCCTCCTTATGA, downstream forward: _UP4_TAGCGAAAAGGGTCAGGAGG
  • References

  • 22383849,22686449,24161940