SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional antiterminator, controls expression of the [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] operon
33.03 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
control of glucose uptake
transcriptional antiterminator of the [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] operon

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,456,092 → 1,456,958

    The protein

    Catalyzed reaction/ biological activity

  • [SW|PRD-containing transcription factors|transcription antiterminator] , RNA-binding protein, binds the ''[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]'' RAT sequence
  • Protein family

  • [SW|PRD-containing transcription factors|transcription antiterminator] of the BglG/ [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY] family
  • Paralogous protein(s)

  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY], [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT]
  • [SW|Domains]

  • RNA-binding domain (N-terminal, constitutive antiterminator)
  • 2x [SW|PTS] regulation domains ([SW|PRD]s) (C-terminal, neg. regulated by [protein|B5E7EB475434E96786C577AE709A21BD702733D8|PtsG])
  • Modification

  • phosphorylation (His104)
  • Structure

  • [PDB|3RIO] (RBD-[SW|PRD]-I) [Pubmed|22750856]
  • [PDB|3GWH] ([SW|PRD]-II) [Pubmed|19684596]
  • Expression and Regulation


    view in new tab

    Biological materials


  • available in [SW|Jörg Stülke]'s lab:
  • GP109 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT], in frame deletion)
  • GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
  • GP926 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::tet) [Pubmed|22722928]
  • BKE13880 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATACCTCATATCGT, downstream forward: _UP4_TAAATTCAGTTTATCCTTAT
  • BKK13880 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATACCTCATATCGT, downstream forward: _UP4_TAAATTCAGTTTATCCTTAT
  • Expression vectors

  • pGP124 (full length, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP114 (amino acids 1-60, RNA-binding domain, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP230 (amino acids 1-60, RNA-binding domain with thrombin cleavage site, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP164 (both PRDs, in [SW|pWH844]), in addition diverse Expression vector for phosphorylation site mutants and for RBD mutants (all in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP424 (PRDI, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP425 (PRDII, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP442 (PRDI, in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
  • pGP443 (PRDII, in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
  • pGP575 (amino acids 1-60, RNA-binding domain with Strep-tag, in [SW|pGP574]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1224 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1220 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References


  • 9663674,18086213
  • Original publications

  • 11902727,9765562,12437213,10543968,17074746,15155854,14527945,19684596,22722928,20939030,22750856,30082753