SubtiBank SubtiBank
pit
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pit

low-affinity inorganic phosphate transporter, proton symporter
locus
BSU_12840
pI
10.45
mw
34.63 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast
function
phosphate uptake
product
low-affinity inorganic phosphate transporter, proton symporter
essential
no
synonyms
ykaB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.8|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,349,468 → 1,350,469

    The protein

    Protein family

  • inorganic phosphate transporter (PiT) (TC 2.A.20) family (with [protein|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|CysP], according to UniProt)
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|BBA93C5BAA044DA61A2D1E0EE850A12391E8A3E3|ykaA]-[gene|BBFA6A5EE16CE6203AF89573F87678395277C9E8|pit]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A735 (pit::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/735 NBRP B. subtilis, Japan]
  • BKE12840 (Δ[gene|BBFA6A5EE16CE6203AF89573F87678395277C9E8|pit]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGAATATCCATTTTTACCC, downstream forward: _UP4_TAATGTCACACCGCTTCTGT
  • BKK12840 (Δ[gene|BBFA6A5EE16CE6203AF89573F87678395277C9E8|pit]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGAATATCCATTTTTACCC, downstream forward: _UP4_TAATGTCACACCGCTTCTGT
  • References

    Reviews

  • 9442271
  • Original publications

  • 18763711,7033203,27965289