SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


mother cell-specific sporulation protein
21.11 kDa
protein length
186 aa Sequence Blast
gene length
561 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,714,933 → 2,715,493

    The protein


  • [SW|cupin 2 domain] (aa 89 ... 164)
  • Structure

  • [PDB|2OA2] (the [SW|cupin 2 domain], from B. halodurans, 66% identity)
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]) [Pubmed|15699190,12480901]
  • view in new tab

    Biological materials


  • MGNA-C456 (yrkC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE26560 (Δ[gene|BBF2D58DFC1E345BB841AFDFEF5E651715B1426B|yrkC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTGATCCCCGCAAT, downstream forward: _UP4_TAGCACAGATATTCTGGAGA
  • BKK26560 (Δ[gene|BBF2D58DFC1E345BB841AFDFEF5E651715B1426B|yrkC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTGATCCCCGCAAT, downstream forward: _UP4_TAGCACAGATATTCTGGAGA
  • References

  • 15699190,12480901