SubtiBank SubtiBank
rpmGB [2019-06-06 17:04:18]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

rpmGB [2019-06-06 17:04:18]

ribosomal protein
5.36 kDa
protein length
gene length
150 bp Sequence Blast
ribosomal protein L33b

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal proteins]
  • Gene

    117,349 → 117,498

    The protein

    Protein family

  • [SW|ribosomal protein] L33P family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|D73FC9CAD929919050837824B4794F9FC9E83052|RpmGA], [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC]
  • [SW|Cofactors]

  • requires zinc for activity [Pubmed|19648245]
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1898930], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|7592498], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logrithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|7592498]
  • view in new tab

    Biological materials


  • BKE00990 (Δ[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTACACCTTTTTC, downstream forward: _UP4_TAGTTTTTGCGCTTTTAAAT
  • BKK00990 (Δ[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTACACCTTTTTC, downstream forward: _UP4_TAGTTTTTGCGCTTTTAAAT
  • References

  • 19648245,19653700,23002217,25903689