SubtiBank SubtiBank
rpmGB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpmGB

ribosomal protein
locus
BSU_00990
pI
9.89
mw
5.36 kDa
protein length
gene length
150 bp Sequence Blast
function
translation
product
ribosomal protein L33b
essential
no
synonyms
rpmG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    117,349 → 117,498

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL33 family (with [protein|D73FC9CAD929919050837824B4794F9FC9E83052|RpmGA] and [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC], according to UniProt)
  • Paralogous protein(s)

  • [protein|D73FC9CAD929919050837824B4794F9FC9E83052|RpmGA], [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC]
  • [SW|Cofactors]

  • requires zinc for activity [Pubmed|19648245]
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]-[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]-[gene|1007EA15FB7AF81A44400287DB68BCC497158ACF|secE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1898930], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|7592498], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logrithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|7592498]
  • view in new tab

    Biological materials

    Mutant

  • BKE00990 (Δ[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTACACCTTTTTC, downstream forward: _UP4_TAGTTTTTGCGCTTTTAAAT
  • BKK00990 (Δ[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTACACCTTTTTC, downstream forward: _UP4_TAGTTTTTGCGCTTTTAAAT
  • References

  • 19648245,19653700,23002217,25903689