SubtiBank SubtiBank
yjaZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjaZ

unknown
locus
BSU_11350
pI
9.14
mw
29.84 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,210,500 → 1,211,285

    Biological materials

    Mutant

  • MGNA-B146 (yjaZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1145 NBRP B. subtilis, Japan]
  • BKE11350 (Δ[gene|BBCCC320EB2B27F8F7A59711B13133BB843C43BF|yjaZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCTCCTCTTT, downstream forward: _UP4_TAAAAGGATAAAATAATGGA
  • BKK11350 (Δ[gene|BBCCC320EB2B27F8F7A59711B13133BB843C43BF|yjaZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCTCCTCTTT, downstream forward: _UP4_TAAAAGGATAAAATAATGGA