SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


29.84 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    1,210,500 → 1,211,285

    Biological materials


  • MGNA-B146 (yjaZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11350 (Δ[gene|BBCCC320EB2B27F8F7A59711B13133BB843C43BF|yjaZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCTCCTCTTT, downstream forward: _UP4_TAAAAGGATAAAATAATGGA
  • BKK11350 (Δ[gene|BBCCC320EB2B27F8F7A59711B13133BB843C43BF|yjaZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCTCCTCTTT, downstream forward: _UP4_TAAAAGGATAAAATAATGGA