SubtiBank SubtiBank
ydjC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydjC

unknown
locus
BSU_06130
pI
7.88
mw
13.50 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    664,319 → 664,669

    Expression and Regulation

    Operons

    genes
    [gene|BBC6001BB36DF24DA401240387D75AF472F7FE20|ydjC]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/ydjC.html DBTBS]) null

    regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C211 (ydjC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2209 NBRP B. subtilis, Japan]
  • BKE06130 (Δ[gene|BBC6001BB36DF24DA401240387D75AF472F7FE20|ydjC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTACATCAATTTTCGATT, downstream forward: _UP4_TGATACATTTGTAGACTTTA
  • BKK06130 (Δ[gene|BBC6001BB36DF24DA401240387D75AF472F7FE20|ydjC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTACATCAATTTTCGATT, downstream forward: _UP4_TGATACATTTGTAGACTTTA
  • References

  • 27766092