SubtiBank SubtiBank
araL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

araL

sugar phosphate phosphatase, L-arabinose operon
locus
BSU28770
pI
5.37
mw
29.16 kDa
protein length
272 aa Sequence Blast
gene length
819 bp Sequence Blast
function
detoxification of accidental accumulation of phosphorylated metabolites
product
sugar phosphate phosphatase
essential
no
synonyms
yseA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,944,187 → 2,945,005

    The protein

    Protein family

  • [SW|HAD superfamily]
  • Structure

  • [PDB|3QGM] (from ''Archaeoglobus Fulgidus'' (35%) )
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|028428CE456E283C065756878EA7C7DB495DD10D|araA]-[gene|E0525A4187D9C8A23F23BC8F883973896C8D295D|araB]-[gene|3859854178E573AE8ACCE6DF85E32C495D316DA1|araD]-[gene|BBAD1638F435791C1846EFFAD6B6F82CE491FDF1|araL]-[gene|16EE17461B4AB467A4F8172FD3E335073AD2B1D8|araM]-[gene|C1F5D0EA21DCA5F8EC43720CDF67E859CA7B866E|araN]-[gene|8AF43CA410F3381209196E1B9A4FE66D78020793|araP]-[gene|AE532A8931D516CC676E765D1D1293E73C335D23|araQ]-[gene|2B2629D275491A9F7031D5A99BAA001B011A765B|abfA]
    description
    [Pubmed|9084180]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084180], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12949161], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|A567466894AE9DE7CDE7816615433A37532297B5|AraR]: repression, [Pubmed|10417639], in [regulon|A567466894AE9DE7CDE7816615433A37532297B5|AraR regulon]
  • regulation

  • induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B015 (araL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1014 NBRP B. subtilis, Japan]
  • BKE28770 (Δ[gene|BBAD1638F435791C1846EFFAD6B6F82CE491FDF1|araL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCCAGCCGGTGACACAG, downstream forward: _UP4_TTGGCTGAGGAGGGGATTCT
  • BKK28770 (Δ[gene|BBAD1638F435791C1846EFFAD6B6F82CE491FDF1|araL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCCAGCCGGTGACACAG, downstream forward: _UP4_TTGGCTGAGGAGGGGATTCT
  • References

  • 9084180,10417639,12949161,27784292