SubtiBank SubtiBank
ykfD

ykfD

similar to oligopeptide [SW|ABC transporter ](permease)
locus
BSU_13000
pI
9.34
mw
36.83 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.3|Uptake of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.4|Utilization of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,368,844 → 1,369,833

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|OppF], [protein|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|AppF]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 7-252) (according to UniProt)
  • Structure

  • [PDB|4FWI] (dipeptide transporter from ''Thermoanaerobacter tengcongensis'', 36% identity) [Pubmed|23385461]
  • [SW|Localization]

  • attached to the cell membrane (via [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|DppB]-[protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|DppC]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A743 (ykfD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/743 NBRP B. subtilis, Japan]
  • BKE13000 (Δ[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTCCCTCCTTATT, downstream forward: _UP4_TAAATAAAAAGAGTGGCTCC
  • BKK13000 (Δ[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTCCCTCCTTATT, downstream forward: _UP4_TAAATAAAAAGAGTGGCTCC
  • References

  • 12618455,10092453,23385461