SubtiBank SubtiBank
ykfD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykfD

similar to oligopeptide [SW|ABC transporter ](permease)
locus
BSU_13000
pI
9.34
mw
36.83 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.3|Uptake of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.4|Utilization of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,368,844 → 1,369,833

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|OppF], [protein|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|AppF]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 7-252) (according to UniProt)
  • Structure

  • [PDB|4FWI] (dipeptide transporter from ''Thermoanaerobacter tengcongensis'', 36% identity) [Pubmed|23385461]
  • [SW|Localization]

  • attached to the cell membrane (via [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|DppB]-[protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|DppC]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A743 (ykfD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/743 NBRP B. subtilis, Japan]
  • BKE13000 (Δ[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTCCCTCCTTATT, downstream forward: _UP4_TAAATAAAAAGAGTGGCTCC
  • BKK13000 (Δ[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCTCCCTCCTTATT, downstream forward: _UP4_TAAATAAAAAGAGTGGCTCC
  • References

  • 12618455,10092453,23385461