SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


23.44 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,360,630 → 2,361,502

    The protein

    Protein family

  • [SW|UPF0750 membrane proteins] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE22510 (Δ[gene|BB85AB2A650C677556B8280ACB74833E9B7D1330|ypjC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACACAAAACCCCTTTT, downstream forward: _UP4_TGACATGTAATAGAAAAAAG
  • BKK22510 (Δ[gene|BB85AB2A650C677556B8280ACB74833E9B7D1330|ypjC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACACAAAACCCCTTTT, downstream forward: _UP4_TGACATGTAATAGAAAAAAG