SubtiBank SubtiBank
yfhP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfhP

unknown
locus
BSU_08620
pI
9.15
mw
36.97 kDa
protein length
327 aa Sequence Blast
gene length
984 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    934,457 → 935,440

    The protein

    Catalyzed reaction/ biological activity

  • may act as negative regulator of transcription of the ''[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]-[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]'' operon [Pubmed|10463184]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]
    description
    [Pubmed|10463184]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|10463184], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|10463184]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C321 (yfhP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2319 NBRP B. subtilis, Japan]
  • BKE08620 (Δ[gene|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGTGACCTCCTTGCAG, downstream forward: _UP4_CTTCAGAAAAAATTAAAGCT
  • BKK08620 (Δ[gene|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGTGACCTCCTTGCAG, downstream forward: _UP4_CTTCAGAAAAAATTAAAGCT
  • References

  • 10463184