SubtiBank SubtiBank
ygaE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ygaE

unknown
locus
BSU_08700
pI
6.02
mw
40.58 kDa
protein length
353 aa Sequence Blast
gene length
1062 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    941,168 → 942,229

    The protein

    Protein family

  • UPF0421 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BB3716E24A7BE7C0108ABCFF9C9B67A0F15457AA|ygaE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A250 (ygaE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/250 NBRP B. subtilis, Japan]
  • GP2184 (''[gene|BB3716E24A7BE7C0108ABCFF9C9B67A0F15457AA|ygaE]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE08700 (Δ[gene|BB3716E24A7BE7C0108ABCFF9C9B67A0F15457AA|ygaE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTTTGTGCGTGCATT, downstream forward: _UP4_TAACCCGGTTAAACAGCCGG
  • BKK08700 (Δ[gene|BB3716E24A7BE7C0108ABCFF9C9B67A0F15457AA|ygaE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTTTGTGCGTGCATT, downstream forward: _UP4_TAACCCGGTTAAACAGCCGG