SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcription factor
20.87 kDa
protein length
191 aa Sequence Blast
gene length
576 bp Sequence Blast
similar to transcription factor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    2,081,172 → 2,081,747

    The protein


  • [SW|HTH tetR-type domain] (aa 6-66) (according to UniProt)
  • Structure

  • [PDB|1ZK8] (from B. cereus, 42% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A315 (yobS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19070 (Δ[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCTATTCTCGGTGACATGC, downstream forward: _UP4_TAAACAAATAAATGGATGTC
  • BKK19070 (Δ[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCTATTCTCGGTGACATGC, downstream forward: _UP4_TAAACAAATAAATGGATGTC