SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


serine hydroxymethyltransferase
45.33 kDa
protein length
415 aa Sequence Blast
gene length
1245 bp Sequence Blast
biosynthesis of glycine
serine hydroxymethyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    3,789,190 → 3,790,437

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • inactivation of ''[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]'' suppresses the synthetic lethality of the ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant [Pubmed|27983482]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + glycine + H2O --> (6S)-5,6,7,8-tetrahydrofolate + L-serine (according to UniProt)
  • Protein family

  • SHMT family (single member, according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705], [Pubmed|17726680]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|2VGU] (complex with L-serine, Geobacillus stearothermophilus), [PDB|2VI8] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11591660], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • induced by glycine limitation ([regulon|T-box|T-box]) [Pubmed|19258532]
  • view in new tab

    Biological materials


  • BKE36900 (Δ''[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE36900 (Δ[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGAGATCCTCTCCT, downstream forward: _UP4_TAAGATCCTAAAACCCGCTT
  • BKK36900 (Δ[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGAGATCCTCTCCT, downstream forward: _UP4_TAAGATCCTAAAACCCGCTT
  • References

  • 19258532,11591660,20152942,19171795,17726680,16493705,15378759,27983482,28189581