SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


serine hydroxymethyltransferase
45.33 kDa
protein length
415 aa Sequence Blast
gene length
1245 bp Sequence Blast
biosynthesis of glycine
serine hydroxymethyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    3,789,190 → 3,790,437

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • inactivation of ''[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]'' suppresses the synthetic lethality of the ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant [Pubmed|27983482]
  • The protein

    Catalyzed reaction/ biological activity

  • 5,10-methylenetetrahydrofolate + glycine + H2O = tetrahydrofolate + L-serine (according to Swiss-Prot)
  • Protein family

  • SHMT family (according to Swiss-Prot)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705], [Pubmed|17726680]
  • Structure

  • [PDB|2VGU] (complex with L-serine, Geobacillus stearothermophilus), [PDB|2VI8] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation


    (according to [ DBTBS]) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11591660], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • induced by glycine limitation ([protein|search|T-box]) [Pubmed|19258532]
  • view in new tab

    Biological materials


  • BKE36900 (Δ''[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE36900 (Δ[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGAGATCCTCTCCT, downstream forward: _UP4_TAAGATCCTAAAACCCGCTT
  • BKK36900 (Δ[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGAGATCCTCTCCT, downstream forward: _UP4_TAAGATCCTAAAACCCGCTT
  • References

  • 19258532,11591660,20152942,19171795,17726680,16493705,15378759,27983482,28189581