SubtiBank SubtiBank
glyA
The papers of the month are back! Check them out! Link here

glyA

serine hydroxymethyltransferase
locus
BSU36900
pI
5.47
mw
45.33 kDa
protein length
415 aa Sequence Blast
gene length
1245 bp Sequence Blast
function
biosynthesis of glycine
product
serine hydroxymethyltransferase
essential
no
ec
2.1.2.1
synonyms
glyC,ipc-34d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.8|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,789,190 → 3,790,437

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • inactivation of ''[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]'' suppresses the synthetic lethality of the ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant [Pubmed|27983482]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • 5,10-methylenetetrahydrofolate + glycine + H2O = tetrahydrofolate + L-serine (according to Swiss-Prot)
  • Protein family

  • SHMT family (according to Swiss-Prot)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705], [Pubmed|17726680]
  • Structure

  • [PDB|2VGU] (complex with L-serine, Geobacillus stearothermophilus), [PDB|2VI8] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/glyA.html DBTBS]) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11591660], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • induced by glycine limitation ([protein|search|T-box]) [Pubmed|19258532]
  • view in new tab

    Biological materials

    Mutant

  • BKE36900 (Δ''[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE36900 (Δ[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGAGATCCTCTCCT, downstream forward: _UP4_TAAGATCCTAAAACCCGCTT
  • BKK36900 (Δ[gene|BAE8062DA8538C9C83FFBA9684BECE9613EEFD2F|glyA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGAGATCCTCTCCT, downstream forward: _UP4_TAAGATCCTAAAACCCGCTT
  • References

  • 19258532,11591660,20152942,19171795,17726680,16493705,15378759,27983482,28189581