SubtiBank SubtiBank
yraM [2019-07-08 08:57:32]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yraM [2019-07-08 08:57:32]

similar to methylitaconate isomerase
locus
BSU26880
pI
5.67
mw
39.38 kDa
protein length
367 aa Sequence Blast
gene length
1104 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,746,608 → 2,747,711

    The protein

    Structure

  • [PDB|3G7K] (from Eubacterium barkeri, 47% identity) [pubmed|19559030]
  • Biological materials

    Mutant

  • MGNA-A237 (yraM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/237 NBRP B. subtilis, Japan]
  • BKE26880 (Δ[gene|BAD7DE1E8FB5E6B3D0C4AC14EDB383AC8E56E5A5|yraM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCATCATCCTCATCT, downstream forward: _UP4_TAGATGGACTGTGCAAAAAG
  • BKK26880 (Δ[gene|BAD7DE1E8FB5E6B3D0C4AC14EDB383AC8E56E5A5|yraM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCATCATCCTCATCT, downstream forward: _UP4_TAGATGGACTGTGCAAAAAG
  • References

    Research papers

  • 19559030