SubtiBank SubtiBank
yraM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraM

similar to methylitaconate isomerase
locus
BSU_26880
pI
5.67
mw
39.38 kDa
protein length
367 aa Sequence Blast
gene length
1104 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,746,608 → 2,747,711

    The protein

    Protein family

  • PrpF family (single member, according to UniProt)
  • Structure

  • [PDB|3G7K] (from Eubacterium barkeri, 47% identity) [pubmed|19559030]
  • Biological materials

    Mutant

  • MGNA-A237 (yraM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/237 NBRP B. subtilis, Japan]
  • BKE26880 (Δ[gene|BAD7DE1E8FB5E6B3D0C4AC14EDB383AC8E56E5A5|yraM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCATCATCCTCATCT, downstream forward: _UP4_TAGATGGACTGTGCAAAAAG
  • BKK26880 (Δ[gene|BAD7DE1E8FB5E6B3D0C4AC14EDB383AC8E56E5A5|yraM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTCATCATCCTCATCT, downstream forward: _UP4_TAGATGGACTGTGCAAAAAG
  • References

    Research papers

  • 19559030