SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glutamine [SW|ABC transporter] (binding protein)
29.60 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
glutamine uptake
glutamine [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,803,108 → 2,803,929

    The protein

    Protein family

  • [SW|bacterial solute-binding protein 3 family] (according to UniProt)
  • Structure

  • [PDB|2V25] (from ''Campylobacter jejuni'', 37% identity) [Pubmed|17631313]
  • [SW|Localization]

  • attached to the membrane via [protein|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|GlnM]-[protein|CD32011A08697B2C121996A02F1BD7BE4F932778|GlnP] [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|15699190]
  • view in new tab

    Biological materials


  • GP734 (spc), available in the [SW|Stülke] lab
  • BKE27440 (Δ[gene|BAB70547672C855AEB3A4D4624044340CF582848|glnH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAGCTCCCCCATTTC, downstream forward: _UP4_TAACAACCATCCCGGGATGA
  • BKK27440 (Δ[gene|BAB70547672C855AEB3A4D4624044340CF582848|glnH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAGCTCCCCCATTTC, downstream forward: _UP4_TAACAACCATCCCGGGATGA
  • References

  • 10092453,12823818,25755103,15699190,17631313,20023025