SubtiBank SubtiBank
yqbG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbG

unknown
locus
BSU_26120
pI
4.41
mw
14.56 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,682,486 → 2,682,881

    The protein

    Structure

  • [PDB|1ZTS] [pubmed|16281282]
  • Expression and Regulation

    Operons

    genes
    [gene|BAA22A95A8CF2F4DE1BD55F94DBE279184F0D4D1|yqbG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE26120 (Δ[gene|BAA22A95A8CF2F4DE1BD55F94DBE279184F0D4D1|yqbG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGGGAGTGATTAACAGCA, downstream forward: _UP4_GCGAAAGTGCGGATGAGATC
  • BKK26120 (Δ[gene|BAA22A95A8CF2F4DE1BD55F94DBE279184F0D4D1|yqbG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGGGAGTGATTAACAGCA, downstream forward: _UP4_GCGAAAGTGCGGATGAGATC
  • References

    Research papers

  • 16281282