SubtiBank SubtiBank
yqbG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbG

unknown
locus
BSU26120
pI
4.41
mw
14.56 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,682,486 → 2,682,881

    The protein

    Structure

  • [PDB|1ZTS] [pubmed|16281282]
  • Expression and Regulation

    Operons

    genes
    [gene|BAA22A95A8CF2F4DE1BD55F94DBE279184F0D4D1|yqbG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE26120 (Δ[gene|BAA22A95A8CF2F4DE1BD55F94DBE279184F0D4D1|yqbG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGGGAGTGATTAACAGCA, downstream forward: _UP4_GCGAAAGTGCGGATGAGATC
  • BKK26120 (Δ[gene|BAA22A95A8CF2F4DE1BD55F94DBE279184F0D4D1|yqbG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGGGAGTGATTAACAGCA, downstream forward: _UP4_GCGAAAGTGCGGATGAGATC
  • References

    Research papers

  • 16281282