SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phage-derived gamma polyglutamate hydrolase
22.70 kDa
protein length
200 aa Sequence Blast
gene length
603 bp Sequence Blast
polyglutamate degradation
phage-derived gamma polyglutamic acid hydrolase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,319,011 → 1,319,613

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of polyglutamic acid [Pubmed|26158264]
  • Protein family

  • [SW|UPF0714 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|DF95DED9A6E2160C151D7664C951B198EEA225E8|PghC], [protein|FD862CE6C4A37B17714F8F8687B3266D43EF5F63|PghL], [protein|8F9DCD77660706E4D25CD7875C014F6A2B5D8123|PghZ]
  • [SW|Domains]

  • DUF867 [ x], [[gamma-PGA hydrolase domain]] [Pubmed|26158264]
  • Structure

  • [PDB|3A9L] (from B. subtilis phage NIT1, 41% identity) [pubmed|22105902]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B305 (yjqB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12480 (Δ[gene|BA7D1D112E934B68073DFC1F76248ED6157240E3|pghB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAACGCCCCCCTTT, downstream forward: _UP4_TAAAACTAGACGGGACCTGC
  • BKK12480 (Δ[gene|BA7D1D112E934B68073DFC1F76248ED6157240E3|pghB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAACGCCCCCCTTT, downstream forward: _UP4_TAAAACTAGACGGGACCTGC
  • References

  • 26158264,22105902