SubtiBank SubtiBank
pghB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pghB

phage-derived gamma polyglutamate hydrolase
locus
BSU_12480
pI
6.42
mw
22.70 kDa
protein length
200 aa Sequence Blast
gene length
603 bp Sequence Blast
function
polyglutamate degradation
product
phage-derived gamma polyglutamic acid hydrolase
essential
no
synonyms
yjqB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    Coordinates
    1,319,011 → 1,319,613

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of polyglutamic acid [Pubmed|26158264]
  • Protein family

  • [SW|UPF0714 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|DF95DED9A6E2160C151D7664C951B198EEA225E8|PghC], [protein|FD862CE6C4A37B17714F8F8687B3266D43EF5F63|PghL], [protein|8F9DCD77660706E4D25CD7875C014F6A2B5D8123|PghZ]
  • [SW|Domains]

  • DUF867 [http://pfam.xfam.org/family/PF05908 x], [[gamma-PGA hydrolase domain]] [Pubmed|26158264]
  • Structure

  • [PDB|3A9L] (from B. subtilis phage NIT1, 41% identity) [pubmed|22105902]
  • Expression and Regulation

    Operons

    genes
    [gene|BA7D1D112E934B68073DFC1F76248ED6157240E3|pghB]-[gene|59EC45E8731FE989152553A69ACEF6569E88F85C|yjqC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B305 (yjqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1304 NBRP B. subtilis, Japan]
  • BKE12480 (Δ[gene|BA7D1D112E934B68073DFC1F76248ED6157240E3|pghB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAACGCCCCCCTTT, downstream forward: _UP4_TAAAACTAGACGGGACCTGC
  • BKK12480 (Δ[gene|BA7D1D112E934B68073DFC1F76248ED6157240E3|pghB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAACGCCCCCCTTT, downstream forward: _UP4_TAAAACTAGACGGGACCTGC
  • References

  • 26158264,22105902