SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


single-strand DNA-specific exonuclease, acts together with [protein|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|RecQ] in replication fork maintenance
87.83 kDa
protein length
786 aa Sequence Blast
gene length
2361 bp Sequence Blast
replication fork maintenance
single-strand DNA-specific exonuclease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    2,823,419 → 2,825,779

    Phenotypes of a mutant

  • ''[gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] [gene|BA755FA1CB1E0C006E9A23489A7C8997141AA498|recJ]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
  • suppression of lethality of [gene|C73E52D214E24F21696973B19B0A44CE785D6FBA|pcrA] inactivation [pubmed|32793628]
  • The protein

    Protein family

  • RecJ family (with [protein|CDFA18E1C0445302ED4D8F93F88822EC6BD646BB|YorK], according to UniProt)
  • Paralogous protein(s)

  • [protein|CDFA18E1C0445302ED4D8F93F88822EC6BD646BB|YorK]
  • [SW|Domains]

  • [SW|DHH-DHHA1 domain]
  • [SW|Cofactors]

  • Mn2+ [pubmed|27058167]
  • Structure

  • [PDB|5F54] (from Deinococcus radiodurans, the [SW|DHH-DHHA1 domain], 32% identity) [pubmed|27058167]
  • [SW|Localization]

  • associated with the [SW|replisome] [pubmed|21170359]
  • bound to replication forks, but also assembles at many sites on the nucleoid upon DNA damage induction [pubmed|30401797]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • MGNA-B516 (yrvE::erm), available at the [ NBRP B. subtilis, Japan]
  • GP895 (''[gene|BA755FA1CB1E0C006E9A23489A7C8997141AA498|recJ]''::''kan''), available in [SW|Jörg Stülke]'s lab
  • BKE27620 (''[gene|BA755FA1CB1E0C006E9A23489A7C8997141AA498|recJ]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE27620 (Δ[gene|BA755FA1CB1E0C006E9A23489A7C8997141AA498|recJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATTCACCCCTCAACC, downstream forward: _UP4_AGTACGAGGAGGACATAAAA
  • BKK27620 (Δ[gene|BA755FA1CB1E0C006E9A23489A7C8997141AA498|recJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATTCACCCCTCAACC, downstream forward: _UP4_AGTACGAGGAGGACATAAAA
  • References


  • 22933559,32286623
  • Original publications

  • 15241682,11948165,10498723,21170359,21205011,26001966,27058167,30401797,32793628