SubtiBank SubtiBank
queD [2018-01-10 10:47:31]
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

queD [2018-01-10 10:47:31]

6-pyruvoyltetrahydropterin synthase, synthesis of the modified ribonucleotide queuosine
locus
BSU13730
pI
5.94
mw
16.71 kDa
protein length
149 aa Sequence Blast
gene length
447 bp Sequence Blast
function
tRNA modification
product
6-pyruvoyltetrahydropterin synthase
essential
no
synonyms
ykvK

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    1,440,100 → 1,440,549

    Expression and Regulation

    Operons

    genes
    [gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]-[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]-[gene|F5189CAA5EF43FCF95E593E095F84B3BE486B347|queE]-[gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]
    description
    [Pubmed|14660578]

    regulatory mechanism

  • [regulon|preQ1 riboswitch|preQ1 riboswitch]: antitermination, in the absence of queuosine [Pubmed|19285444], in [regulon|preQ1 riboswitch|preQ1 riboswitch]
  • regulation

  • repressed in the presence of queuosine ([SW|preQ1 riboswitch]) [Pubmed|19285444]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B325 (ykvK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1324 NBRP B. subtilis, Japan]
  • BKE13730 (Δ[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTATGCACGCTCTCCTTT, downstream forward: _UP4_TGAATGGCTAAAGGAATTCC
  • BKK13730 (Δ[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTATGCACGCTCTCCTTT, downstream forward: _UP4_TGAATGGCTAAAGGAATTCC
  • References

  • 16411777,18259064,14660578,19285444,17384645,29303575