SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


6-pyruvoyltetrahydropterin synthase, synthesis of the modified ribonucleotide queuosine
16.71 kDa
protein length
149 aa Sequence Blast
gene length
447 bp Sequence Blast
tRNA modification
6-pyruvoyltetrahydropterin synthase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    1,440,100 → 1,440,549

    The protein


  • [PDB|3QN0] (from E. coli, 33% identity) [pubmed|24816091]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|preQ1 riboswitch|preQ1 riboswitch]: antitermination, in the absence of queuosine [Pubmed|19285444], in [regulon|preQ1 riboswitch|preQ1 riboswitch]
  • regulation

  • repressed in the presence of queuosine ([SW|preQ1 riboswitch]) [Pubmed|19285444]
  • view in new tab

    Biological materials


  • MGNA-B325 (ykvK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13730 (Δ[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTATGCACGCTCTCCTTT, downstream forward: _UP4_TGAATGGCTAAAGGAATTCC
  • BKK13730 (Δ[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTATGCACGCTCTCCTTT, downstream forward: _UP4_TGAATGGCTAAAGGAATTCC
  • References

  • 16411777,18259064,14660578,19285444,17384645,24816091