SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


NADPH-FMN oxidoreductase, delivers reduced FMN to enzymes that require the reduced cofactor for activity
27.72 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
delivery of FMN to enzymes
NADPH-FMN oxidoreductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • Gene

    438,516 → 439,265

    The protein

    Catalyzed reaction/ biological activity

  • FMNH2 + NADP+ --> FMN + 2 H+ + NADPH (according to UniProt)
  • FMNH2 + NAD+ --> FMN + 2 H+ + NADH (according to UniProt)
  • Protein family

  • flavin oxidoreductase frp family (with [protein|5B95F7CFEFCB954FCBC11087F030A1D777F34B7A|NfrA], according to UniProt)
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|1ZCH]
  • Expression and Regulation




  • induced by chromanon [Pubmed|17407181]
  • view in new tab

    Biological materials


  • MGNA-C013 (ycnD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03860 (Δ[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGACACCCTTCCTT, downstream forward: _UP4_TAAGCTCTTATTCGGCCTGT
  • BKK03860 (Δ[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGACACCCTTCCTT, downstream forward: _UP4_TAAGCTCTTATTCGGCCTGT
  • References

  • 16229462,17407181