SubtiBank SubtiBank
ycnD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycnD

NADPH-FMN oxidoreductase, delivers reduced FMN to enzymes that require the reduced cofactor for activity
locus
BSU03860
pI
5.08
mw
27.72 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
function
delivery of FMN to enzymes
product
NADPH-FMN oxidoreductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • Gene

    Coordinates
    438,516 → 439,265

    The protein

    Protein family

  • flavin oxidoreductase frp family (according to Swiss-Prot)
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|1ZCH]
  • Expression and Regulation

    Operons

    genes
    [gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]-[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]
    description
    [Pubmed|17407181]

    regulation

  • induced by chromanon [Pubmed|17407181]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C013 (ycnD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2011 NBRP B. subtilis, Japan]
  • BKE03860 (Δ[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGACACCCTTCCTT, downstream forward: _UP4_TAAGCTCTTATTCGGCCTGT
  • BKK03860 (Δ[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGACACCCTTCCTT, downstream forward: _UP4_TAAGCTCTTATTCGGCCTGT
  • References

  • 16229462,17407181