SubtiBank SubtiBank
ycnD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycnD

NADPH-FMN oxidoreductase, delivers reduced FMN to enzymes that require the reduced cofactor for activity
locus
BSU_03860
pI
5.08
mw
27.72 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
function
delivery of FMN to enzymes
product
NADPH-FMN oxidoreductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • Gene

    Coordinates
    438,516 → 439,265

    The protein

    Catalyzed reaction/ biological activity

  • FMNH2 + NADP+ --> FMN + 2 H+ + NADPH (according to UniProt)
  • FMNH2 + NAD+ --> FMN + 2 H+ + NADH (according to UniProt)
  • Protein family

  • flavin oxidoreductase frp family (with [protein|5B95F7CFEFCB954FCBC11087F030A1D777F34B7A|NfrA], according to UniProt)
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|1ZCH]
  • Expression and Regulation

    Operons

    genes
    [gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]-[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]
    description
    [Pubmed|17407181]

    regulation

  • induced by chromanon [Pubmed|17407181]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C013 (ycnD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2011 NBRP B. subtilis, Japan]
  • BKE03860 (Δ[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGACACCCTTCCTT, downstream forward: _UP4_TAAGCTCTTATTCGGCCTGT
  • BKK03860 (Δ[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGACACCCTTCCTT, downstream forward: _UP4_TAAGCTCTTATTCGGCCTGT
  • References

  • 16229462,17407181