SubtiBank SubtiBank
ybfO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybfO

similar to erythromycin esterase
locus
BSU_02310
pI
6.68
mw
51.62 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    249,979 → 251,319

    The protein

    Structure

  • [PDB|2QGM] (23% identity)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]-[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]
    description
    [Pubmed|12207695]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]
    description
    [Pubmed|20817675]

    regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/ybfO.html DBTBS]) null

    regulation

  • repressed during logarithmic growth ([protein|search|AbrB]) [Pubmed|18840696]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B935 (ybfO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1934 NBRP B. subtilis, Japan]
  • BKE02310 (Δ[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCTATCTCTCCTTTTC, downstream forward: _UP4_TGAGCGGTGTCCCCTGTGGT
  • BKK02310 (Δ[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCTATCTCTCCTTTTC, downstream forward: _UP4_TGAGCGGTGTCCCCTGTGGT
  • References

  • 18957862,11866510,18840696,12207695,20817675