SubtiBank SubtiBank
ybfO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybfO

similar to erythromycin esterase
locus
BSU_02310
pI
6.68
mw
51.62 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    249,979 → 251,319

    The protein

    Structure

  • [PDB|2QGM] (23% identity)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]-[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]
    description
    [Pubmed|12207695]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]
    description
    [Pubmed|20817675]

    regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/ybfO.html DBTBS]) null

    regulation

  • repressed during logarithmic growth ([protein|search|AbrB]) [Pubmed|18840696]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B935 (ybfO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1934 NBRP B. subtilis, Japan]
  • BKE02310 (Δ[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCTATCTCTCCTTTTC, downstream forward: _UP4_TGAGCGGTGTCCCCTGTGGT
  • BKK02310 (Δ[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCTATCTCTCCTTTTC, downstream forward: _UP4_TGAGCGGTGTCCCCTGTGGT
  • References

  • 18957862,11866510,18840696,12207695,20817675