SubtiBank SubtiBank
ywdJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywdJ

unknown
locus
BSU_37940
pI
10.02
mw
49.81 kDa
protein length
440 aa Sequence Blast
gene length
1323 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-60d

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,894,463 → 3,895,785

    The protein

    Protein family

  • [SW|xanthine/uracil permease family] (according to UniProt)
  • [SW|Nucleobase:cation symporter-2 (NCS2) (TC 2.A.40) subfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F267C75289D19D039F6E97F5DABCDFF0B4E4B8FA|ywdI]-[gene|BA4D8EF5B09345E94EEEEB936C803B71340DC5EE|ywdJ]-[gene|386D4F640E987E3752BEBE57BF25DF487D12EFCE|ywdK]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A565 (ywdJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/565 NBRP B. subtilis, Japan]
  • BKE37940 (Δ[gene|BA4D8EF5B09345E94EEEEB936C803B71340DC5EE|ywdJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCACGTAAGCTCAACCTC, downstream forward: _UP4_TGAATTTTGGTGCAGGTGCG
  • BKK37940 (Δ[gene|BA4D8EF5B09345E94EEEEB936C803B71340DC5EE|ywdJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCACGTAAGCTCAACCTC, downstream forward: _UP4_TGAATTTTGGTGCAGGTGCG
  • References

  • 12823818,25755103